Back to Tool Docs Index


IntegrationSiteMapper

Detect and summarize transgene integration

Category Public/Stable Tools


Overview

This tool was originally designed to inspect the results of Tag-PCR (an assay to measure transgene integration into the genome); however, in theory it could be used with any assay providing similar data. At a high level, it uses the terminal sequence(s) of your transgene to inspect BAM reads for those containing genome-transgene junctions. It determines the orientation of the integration event, and can create a table of these locations. It can additionally reconstruct the genome/transgene sequences for each unique site (which can be tricky when considering orientation). Finally, it can optionally uses these reconstructed sequences to design PCR validation primers (using Primer3), and BLAST those primers against the host genome as validation. It provides a very detailed output, but makes some assumptions and requires specific inputs:

Simplest Usage:

  java -jar DISCVRseq.jar IntegrationSiteMapper \
     -R currentGenome.fasta \
     -b myBam.bam \
     --output-table output.txt \
     --insert-name piggybac
 
The file output.txt will contain a table summarizing the predicted integration sites.

Using More Advanced Features to Reconstruct Transgene/Genome Sequences and Design PCR primers:

  java -jar DISCVRseq.jar IntegrationSiteMapper \
     -R currentGenome.fasta \
     -b myBam.bam \
     --output-table output.txt \
     --primer-pair-table primer_summary.txt \
     --primer3-path /usr/bin/primer3_core \
     --genbank-output output.gb \
     --insert-name lentivirus
 
To generate the full tool output, IntegrationSiteMapper requires a file with a detailed description of the transgene and expected junction sites. Depending on your delivery system, this is likely specific to your plasmid/vector. IntegrationSiteMapper include two built-in transgene schemes, and these can be output to a file as a reference:
  java -jar DISCVRseq.jar IntegrationSiteMapper \
     --write-default-descriptors outputFile.yml
 
which creates:
 name: Lentivirus
 junctions:
 - name: LV-3LTR
   searchStrings: [ AGTGTGGAAAATCTCTAGCA ]
   invertHitOrientation: false
 - name: LV-5LTR
   searchStrings: [ TGGAAGGGCTAATTCACTCC ]
   invertHitOrientation: true
 insertUpstreamRegion:
   name: LV-5LTR
   sequence: TGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGGTAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGATATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
 insertDownstreamRegion:
   name: LV-3LTR
   sequence: TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGGTAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGATATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
 internalPrimers:
 - name: LV-3LTR-Outer
   sequence: GAGAGCTGCATCCGGAGTAC
 - name: LV-3LTR-Inner
   sequence: TAGTGTGTGCCCGTCTGTTG
 - name: LV-5LTR-Outer
   sequence: TCCTCTGGTTTCCCTTTCGC
 - name: LV-5LTR-Inner
   sequence: AAGCAGTGGGTTCCCTAGTT
 
 name: PiggyBac
 junctions:
 - name: PB-3TR
   searchStrings: [ GCAGACTATCTTTCTAGGGTTAA ]
   invertHitOrientation: false
 - name: PB-5TR
   searchStrings: [ ATGATTATCTTTCTAGGGTTAA ]
   invertHitOrientation: true
 insertUpstreamRegion:
   name: PB-5TR
   sequence: TTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGTGTAAAATTGACGCATGTGTTTTATCGGTCTGTATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTATTATATTTACACTTACATACTAATAATAAATTCAACAAACAATTTATTTATGTTTATTTATTTATTAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAACAAAACTTTTATGAGGGACAGCCCCCCCCCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCAGCGAGCCGCCCGGGGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCCGAGCCGGCAGCGTGCGGGGACAGCCCGGGCACGGGGAAGGTGGCACGGGATCGCTTTCCTCTGAACGCTTCTCGCTGCTCTTTGAGCCTGCAGACACCTGGGGGGATA
 insertDownstreamRegion:
   name: PB-3TR
   sequence: CGTAAAAGATAATCATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTGACACTTACCGCATTGACAAGCACGCCTCACGGGAGCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGATTCGCGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAA
 internalPrimers:
 - name: PB-3TR-Nested4
   sequence: CATTGACAAGCACGCCTCAC
 - name: PB-NTSR2-R2
   sequence: GCGACGGATTCGCGCTATTT
 - name: PB-3TR-Nested
   sequence: ATTTCAAGAATGCATGCGTCA
 - name: PB-5TR-New
   sequence: CACATGATTATCTTTAACGTACGTCAC
 - name: PB-RCR1
   sequence: GACCGATAAAACACATGCGTCA
 backboneSearchStrings: [ TCTAGCTGCATCAGGATCAT, TCAGGATCATATCGTCGGGT, TCTAGCTGCGTGTTCTGCAG, GTGTTCTGCAGCGTGTCGAG ]
 
Each block represents the definition of one transgene type, and many sections are optional (although required for certain functions). For the simplest usage (creating a link of integration sites), relatively little is needed. If you want the tool to reconstruct the flanking sequence and/or generate primers, a more complete definition is needed. Pay attention to the orientation of the sequences:

Finally, IntegrationSiteMapper can be run using a custom transgene definition:

  java -jar DISCVRseq.jar IntegrationSiteMapper \
     -R currentGenome.fasta \
     -b myBam.bam \
     --output-table output.txt \
     --insert-definition outputFile.yml
 

Additional Information

Genome/Reference Files

Please note that if this tools uses a reference genome, that FASTA must be indexed with samtools and to have a sequence dictionary created with Picard. See here for more information

Read filters

This Read Filter is automatically applied to the data by the Engine before processing by IntegrationSiteMapper.

IntegrationSiteMapper specific arguments

This table summarizes the command-line arguments that are specific to this tool. For more details on each argument, see the list further down below the table or click on an argument name to jump directly to that entry in the list.

Argument name(s) Default value Summary
Required Arguments
--reference
 -R
null Reference sequence file
Optional Tool Arguments
--allow-zero-mapq
false Allow alignments where MAPQ=0. Some aligners, like BWA-mem, report multi-mapping reads as MAPQ=0
--arguments_file
[] read one or more arguments files and add them to the command line
--backbone-sequences
 -bs
[] If provided, this tool will scan reads for the presence of any of these strings (perfect match-only, but also inspecting for reverse-complement). If found, the read will be counted as overlapping the backbone. This can be useful if the delivery system is a vector, and would allow detection of non-integrated vector
--bam
 -b
null A BAM file with alignments to be inspected
--blast-db-path
 -bdb
null In order for this tool to use BLAST to detect validate the primers by detecting alternate binding sites, the path to a BLAST DB compiled against this reference FASTA must be provided
--blast-threads
 -bt
null If BLAST will be used, this value is passed to the -num_threads argument of blastn.
--blastn-path
 -bn
null The path to the blastn executable. This is required for BLAST validation to be perform against putative primers. If blastn is in your $PATH, it will be picked up. Alternately, the environment variable BLASTN_PATH can be set, pointing to the blastn executable.
--cloud-index-prefetch-buffer
 -CIPB
-1 Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.
--cloud-prefetch-buffer
 -CPB
40 Size of the cloud-only prefetch buffer (in MB; 0 to disable).
--disable-bam-index-caching
 -DBIC
false If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.
--disable-sequence-dictionary-validation
false If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!
--gcs-max-retries
 -gcs-retries
20 If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection
--gcs-project-for-requester-pays
"" Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed. User must have storage.buckets.get permission on the bucket being accessed.
--genbank-output
 -g
null File to which a summary of integration sites, flanking sequence and optionally primers should be written in genbank format
--help
 -h
false display the help message
--include-reverse-reads
 -ir
false By default, reverse reads are skipped. If true, reverse reads will be included, which might be necessary for some chemistries.
--include-sa
 -sa
false If provided, this tool will inspect reads for supplemental alignments (SA tag) and parse these as well
--insert-definition
 -id
[] One or more files describing the insert and transgene/genome junctions. See --write-default-descriptors and --validate-descriptor-only
--insert-name
[] The name of one of the built-in insert descriptors to use. See --write-default-descriptors for available types
--interval-merging-rule
 -imr
ALL Interval merging rule for abutting intervals
--intervals
 -L
[] One or more genomic intervals over which to operate
--metrics-table
 -mt
null File to which a TSV of summary metrics should be written
--min-alignments
 -ma
3 The minimum number of alignments required at a position to report
--min-fraction
 -mf
0.0 Only sites with at least this fraction of total reads will be reported
--min-mapq
 -mmq
20 The minimum MAPQ to consider an alignment
--output-table
 -o
null File to which TSV output should be written
--primer-pair-table
 -pt
null File to which TSV summarizing potential primer pairs should be written
--primer3-path
 -p3
null In order for this tool to design validation primers, the path to primer3 must be provided. If primer3 is in your $PATH, it will be picked up. Alternately, the environment variable PRIMER3_PATH can be set, pointing to the primer3 executable.
--reads-to-output
 -ro
0 If greater than zero, up to this many reads will be written as a FASTA file for each site. This can be useful to validate the junction border
--sites-only-vcf-output
false If true, don't emit genotype fields when writing vcf file output.
--validate-descriptor-only
false If provided, the tool will simply validate the insert definition files (see --insert-definition) and exit
--version
false display the version number for this tool
--write-default-descriptors
null If provided, the tool will write the YAML for the default descriptors to this file and exit. This can be useful as a guide for writing your own descriptors (which is likely needed).
Optional Common Arguments
--add-output-sam-program-record
true If true, adds a PG tag to created SAM/BAM/CRAM files.
--add-output-vcf-command-line
true If true, adds a command line header line to created VCF files.
--create-output-bam-index
 -OBI
true If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.
--create-output-bam-md5
 -OBM
false If true, create a MD5 digest for any BAM/SAM/CRAM file created
--create-output-variant-index
 -OVI
true If true, create a VCF index when writing a coordinate-sorted VCF file.
--create-output-variant-md5
 -OVM
false If true, create a a MD5 digest any VCF file created.
--disable-read-filter
 -DF
[] Read filters to be disabled before analysis
--disable-tool-default-read-filters
false Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)
--exclude-intervals
 -XL
[] One or more genomic intervals to exclude from processing
--gatk-config-file
null A configuration file to use with the GATK.
--input
 -I
[] BAM/SAM/CRAM file containing reads
--interval-exclusion-padding
 -ixp
0 Amount of padding (in bp) to add to each interval you are excluding.
--interval-padding
 -ip
0 Amount of padding (in bp) to add to each interval you are including.
--interval-set-rule
 -isr
UNION Set merging approach to use for combining interval inputs
--inverted-read-filter
 -XRF
[] Inverted (with flipped acceptance/failure conditions) read filters applied before analysis (after regular read filters).
--lenient
 -LE
false Lenient processing of VCF files
--max-variants-per-shard
0 If non-zero, partitions VCF output into shards, each containing up to the given number of records.
--QUIET
false Whether to suppress job-summary info on System.err.
--read-filter
 -RF
[] Read filters to be applied before analysis
--read-index
[] Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.
--read-validation-stringency
 -VS
SILENT Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.
--seconds-between-progress-updates
10.0 Output traversal statistics every time this many seconds elapse
--sequence-dictionary
null Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.
--tmp-dir
null Temp directory to use.
--use-jdk-deflater
 -jdk-deflater
false Whether to use the JdkDeflater (as opposed to IntelDeflater)
--use-jdk-inflater
 -jdk-inflater
false Whether to use the JdkInflater (as opposed to IntelInflater)
--verbosity
INFO Control verbosity of logging.
Advanced Arguments
--showHidden
false display hidden arguments

Argument details

Arguments in this list are specific to this tool. Keep in mind that other arguments are available that are shared with other tools (e.g. command-line GATK arguments); see Inherited arguments above.


--add-output-sam-program-record / -add-output-sam-program-record

If true, adds a PG tag to created SAM/BAM/CRAM files.

boolean  true


--add-output-vcf-command-line / -add-output-vcf-command-line

If true, adds a command line header line to created VCF files.

boolean  true


--allow-zero-mapq / NA

Allow alignments where MAPQ=0. Some aligners, like BWA-mem, report multi-mapping reads as MAPQ=0

boolean  false


--arguments_file / NA

read one or more arguments files and add them to the command line

List[File]  []


--backbone-sequences / -bs

If provided, this tool will scan reads for the presence of any of these strings (perfect match-only, but also inspecting for reverse-complement). If found, the read will be counted as overlapping the backbone. This can be useful if the delivery system is a vector, and would allow detection of non-integrated vector

List[String]  []


--bam / -b

A BAM file with alignments to be inspected

File  null


--blast-db-path / -bdb

In order for this tool to use BLAST to detect validate the primers by detecting alternate binding sites, the path to a BLAST DB compiled against this reference FASTA must be provided

String  null


--blast-threads / -bt

If BLAST will be used, this value is passed to the -num_threads argument of blastn.

Integer  null


--blastn-path / -bn

The path to the blastn executable. This is required for BLAST validation to be perform against putative primers. If blastn is in your $PATH, it will be picked up. Alternately, the environment variable BLASTN_PATH can be set, pointing to the blastn executable.

String  null


--cloud-index-prefetch-buffer / -CIPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable). Defaults to cloudPrefetchBuffer if unset.

int  -1  [ [ -∞  ∞ ] ]


--cloud-prefetch-buffer / -CPB

Size of the cloud-only prefetch buffer (in MB; 0 to disable).

int  40  [ [ -∞  ∞ ] ]


--create-output-bam-index / -OBI

If true, create a BAM/CRAM index when writing a coordinate-sorted BAM/CRAM file.

boolean  true


--create-output-bam-md5 / -OBM

If true, create a MD5 digest for any BAM/SAM/CRAM file created

boolean  false


--create-output-variant-index / -OVI

If true, create a VCF index when writing a coordinate-sorted VCF file.

boolean  true


--create-output-variant-md5 / -OVM

If true, create a a MD5 digest any VCF file created.

boolean  false


--disable-bam-index-caching / -DBIC

If true, don't cache bam indexes, this will reduce memory requirements but may harm performance if many intervals are specified. Caching is automatically disabled if there are no intervals specified.

boolean  false


--disable-read-filter / -DF

Read filters to be disabled before analysis

List[String]  []


--disable-sequence-dictionary-validation / -disable-sequence-dictionary-validation

If specified, do not check the sequence dictionaries from our inputs for compatibility. Use at your own risk!

boolean  false


--disable-tool-default-read-filters / -disable-tool-default-read-filters

Disable all tool default read filters (WARNING: many tools will not function correctly without their default read filters on)

boolean  false


--exclude-intervals / -XL

One or more genomic intervals to exclude from processing
Use this argument to exclude certain parts of the genome from the analysis (like -L, but the opposite). This argument can be specified multiple times. You can use samtools-style intervals either explicitly on the command line (e.g. -XL 1 or -XL 1:100-200) or by loading in a file containing a list of intervals (e.g. -XL myFile.intervals). strings gathered from the command line -XL argument to be parsed into intervals to exclude

List[String]  []


--gatk-config-file / NA

A configuration file to use with the GATK.

String  null


--gcs-max-retries / -gcs-retries

If the GCS bucket channel errors out, how many times it will attempt to re-initiate the connection

int  20  [ [ -∞  ∞ ] ]


--gcs-project-for-requester-pays / NA

Project to bill when accessing "requester pays" buckets. If unset, these buckets cannot be accessed. User must have storage.buckets.get permission on the bucket being accessed.

String  ""


--genbank-output / -g

File to which a summary of integration sites, flanking sequence and optionally primers should be written in genbank format

File  null


--help / -h

display the help message

boolean  false


--include-reverse-reads / -ir

By default, reverse reads are skipped. If true, reverse reads will be included, which might be necessary for some chemistries.

boolean  false


--include-sa / -sa

If provided, this tool will inspect reads for supplemental alignments (SA tag) and parse these as well

boolean  false


--input / -I

BAM/SAM/CRAM file containing reads

List[GATKPath]  []


--insert-definition / -id

One or more files describing the insert and transgene/genome junctions. See --write-default-descriptors and --validate-descriptor-only

List[File]  []


--insert-name / NA

The name of one of the built-in insert descriptors to use. See --write-default-descriptors for available types

List[String]  []


--interval-exclusion-padding / -ixp

Amount of padding (in bp) to add to each interval you are excluding.
Use this to add padding to the intervals specified using -XL. For example, '-XL 1:100' with a padding value of 20 would turn into '-XL 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int  0  [ [ -∞  ∞ ] ]


--interval-merging-rule / -imr

Interval merging rule for abutting intervals
By default, the program merges abutting intervals (i.e. intervals that are directly side-by-side but do not actually overlap) into a single continuous interval. However you can change this behavior if you want them to be treated as separate intervals instead.

The --interval-merging-rule argument is an enumerated type (IntervalMergingRule), which can have one of the following values:

ALL
OVERLAPPING_ONLY

IntervalMergingRule  ALL


--interval-padding / -ip

Amount of padding (in bp) to add to each interval you are including.
Use this to add padding to the intervals specified using -L. For example, '-L 1:100' with a padding value of 20 would turn into '-L 1:80-120'. This is typically used to add padding around targets when analyzing exomes.

int  0  [ [ -∞  ∞ ] ]


--interval-set-rule / -isr

Set merging approach to use for combining interval inputs
By default, the program will take the UNION of all intervals specified using -L and/or -XL. However, you can change this setting for -L, for example if you want to take the INTERSECTION of the sets instead. E.g. to perform the analysis only on chromosome 1 exomes, you could specify -L exomes.intervals -L 1 --interval-set-rule INTERSECTION. However, it is not possible to modify the merging approach for intervals passed using -XL (they will always be merged using UNION). Note that if you specify both -L and -XL, the -XL interval set will be subtracted from the -L interval set.

The --interval-set-rule argument is an enumerated type (IntervalSetRule), which can have one of the following values:

UNION
INTERSECTION

IntervalSetRule  UNION


--intervals / -L

One or more genomic intervals over which to operate

List[String]  []


--inverted-read-filter / -XRF

Inverted (with flipped acceptance/failure conditions) read filters applied before analysis (after regular read filters).

List[String]  []


--lenient / -LE

Lenient processing of VCF files

boolean  false


--max-variants-per-shard / NA

If non-zero, partitions VCF output into shards, each containing up to the given number of records.

int  0  [ [ 0  ∞ ] ]


--metrics-table / -mt

File to which a TSV of summary metrics should be written

File  null


--min-alignments / -ma

The minimum number of alignments required at a position to report

int  3  [ [ -∞  ∞ ] ]


--min-fraction / -mf

Only sites with at least this fraction of total reads will be reported

double  0.0  [ [ -∞  ∞ ] ]


--min-mapq / -mmq

The minimum MAPQ to consider an alignment

int  20  [ [ -∞  ∞ ] ]


--output-table / -o

File to which TSV output should be written

File  null


--primer-pair-table / -pt

File to which TSV summarizing potential primer pairs should be written

File  null


--primer3-path / -p3

In order for this tool to design validation primers, the path to primer3 must be provided. If primer3 is in your $PATH, it will be picked up. Alternately, the environment variable PRIMER3_PATH can be set, pointing to the primer3 executable.

String  null


--QUIET / NA

Whether to suppress job-summary info on System.err.

Boolean  false


--read-filter / -RF

Read filters to be applied before analysis

List[String]  []


--read-index / -read-index

Indices to use for the read inputs. If specified, an index must be provided for every read input and in the same order as the read inputs. If this argument is not specified, the path to the index for each input will be inferred automatically.

List[GATKPath]  []


--read-validation-stringency / -VS

Validation stringency for all SAM/BAM/CRAM/SRA files read by this program. The default stringency value SILENT can improve performance when processing a BAM file in which variable-length data (read, qualities, tags) do not otherwise need to be decoded.

The --read-validation-stringency argument is an enumerated type (ValidationStringency), which can have one of the following values:

STRICT
LENIENT
SILENT

ValidationStringency  SILENT


--reads-to-output / -ro

If greater than zero, up to this many reads will be written as a FASTA file for each site. This can be useful to validate the junction border

int  0  [ [ -∞  ∞ ] ]


--reference / -R

Reference sequence file

R GATKPath  null


--seconds-between-progress-updates / -seconds-between-progress-updates

Output traversal statistics every time this many seconds elapse

double  10.0  [ [ -∞  ∞ ] ]


--sequence-dictionary / -sequence-dictionary

Use the given sequence dictionary as the master/canonical sequence dictionary. Must be a .dict file.

GATKPath  null


--showHidden / -showHidden

display hidden arguments

boolean  false


--sites-only-vcf-output / NA

If true, don't emit genotype fields when writing vcf file output.

boolean  false


--tmp-dir / NA

Temp directory to use.

GATKPath  null


--use-jdk-deflater / -jdk-deflater

Whether to use the JdkDeflater (as opposed to IntelDeflater)

boolean  false


--use-jdk-inflater / -jdk-inflater

Whether to use the JdkInflater (as opposed to IntelInflater)

boolean  false


--validate-descriptor-only / NA

If provided, the tool will simply validate the insert definition files (see --insert-definition) and exit

boolean  false


--verbosity / -verbosity

Control verbosity of logging.

The --verbosity argument is an enumerated type (LogLevel), which can have one of the following values:

ERROR
WARNING
INFO
DEBUG

LogLevel  INFO


--version / NA

display the version number for this tool

boolean  false


--write-default-descriptors / NA

If provided, the tool will write the YAML for the default descriptors to this file and exit. This can be useful as a guide for writing your own descriptors (which is likely needed).

File  null


Return to top


See also General Documentation | Tool Docs Index Tool Docs Index | Issues/Help

DISCVR-Seq version 1.3.92 built at 24-03-2026 03:07:12.